Co-expression by E.coli transformant cells

Carbonyl reductase and glucose dehydrogenase genes

Synthesis of Escherichia coli transformed cells expressing carbonyl reductase and glucose dehydrogenase

Pure optical ethyl (S)-4- chloro -3- hydroxybutyrate

Asymmetric reduction of 4- chloro -3- ethyl.

Oxybutyrate (COBE) was converted into (S)-4- chloro -3- hydroxybutyrate.

((S)-CHBE) was studied. Escherichia coli cells expressing carbonyl reductase (S 1) gene from Candida Mulan and glucose dehydrogenase (GDH) gene from Bacillus megaterium were used as.

Catalyst. In the organic-solvent-water two-phase system, the total amount of (S)-CHBE formed in the organic phase is 2.58 M (430 g/l), and the molar yield is 85%. By continuously feeding COBE, which is unstable in aqueous solution, E.coli transformants which co-produced S 1 and GDH accumulated 1.25 M (208 g/l) (S) -CHBE in aqueous monophasic system. In this case, the calculated value of NADP+ (oxidized form of nicotinamide adenine dinucleotide phosphate) converted into CHBE is 2 1. 600mol/mol. In both systems, the optical purity of (S) -CHBE is 100% enantiomeric excess. The aqueous system used for the reduction reaction involving E.coli HB 10 1 cells carrying plasmids containing S 1 and GDH genes as catalysts is simple. In addition, the system does not need to add commercial GDH or organic solvent. Therefore, this system is very beneficial to the practical synthesis of optically pure (S)-CHBE.

In this paper, the asymmetric synthesis of (S)-4- chloro -3- hydroxybutyrate (CHBE) by COBE was studied. As a catalyst, Escherichia coli cells simultaneously express carbonyl reductase from Candida Mulan E and glucose dehydrogenase gene from Bacillus megaterium. In the water/organic solvent two-phase system, the concentration of (S)-CHBE in the organic phase can reach 2.58M(430g/l), and the molar yield can reach 85%. By-products of E.coli S 1 and GDH also reached 1.25M(208g/l), and COBE was unstable in water phase, so (S)-CHBE could be continuously produced in Dan Xiangzhong water. In this case, the appropriate conversion from NADP+ to CHBE reaches 2 1 600 mol/mol. In this system, the optical rotation of CHBE is 100% enantiomeric excess. It is relatively simple to use Escherichia coli HB 10 1 carrying plasmids containing S 1 and GDH genes as catalysts for asymmetric reduction of aqueous phase. In addition, the system does not require commercial GDH or organic solvents. Therefore, this system is very convenient for the practical synthesis of (S)-CHBE with pure optical activity.

Optically active 4- chloro -3- hydroxybutyrate is a useful chiral component for drug synthesis. The (R)- enantiomer is the precursor of l- carnitine (Zhou et al., 1983), while the (S)- enantiomer is an important raw material of hydroxymethyl glutaryl coenzyme A (HMG-CoA) reductase inhibitor (Karanewsky et al.

Al. 1990). Many studies have described the microbial or enzymatic asymmetric reduction of 4- chloro -3- oxobutyrate (Aragozzini and Valenti1992; Bare et al.1991; Hallinan et al.1995; Patel et al.1992; Qingshui et al.1990; Wong et al. 1985) reduction based on baker's yeast (Zhou et al. 1983). We have previously shown that Candida Mulan AKU4643 cells can reduce ethyl 4- chloro -3- oxobutyrate (COBE) to (S)-CHBE with an enantiomeric excess (E.E.) of 96% in optical purity (Yasohara et al., 1999). As the yeast has at least three different stereoselective reductases (Wada et al., 1998, 1999a, b), the (S)-CHBE produced by the yeast is not optically pure. Among these three enzymes, a NADPH-dependent carbonyl reductase named S 1 was purified and characterized in detail (Wada et al., 1998). We cloned and sequenced the gene encoding S 1 and overexpressed it in E.coli cells. The Escherichia coli transformant reduces COBE to optically pure (S)-CHBE in the presence of glucose, NADP+ and commercially available glucose dehydrogenase (GDH) as a cofactor generator (Yasohara).

Et al, 2000).

Here, we describe the construction of three E.coli transformants co-expressing Clostridium Magnoliae S 1 and Bacillus megaterium GDH gene, and analyze the COBE reduction catalyzed by these strains. Previous reports on enzymatic reduction of COBE to (R)-CHBE with optical purity of 92% e.e (Kataoka et al.,1999; Shimizu et al. (1990) recommended the organic solvent two-phase system reaction for enzyme or microbial reduction, because the substrate (COBE) is unstable in aqueous solvent and inactivates the enzyme. We studied the reduction of COBE to optically pure (S) -CHBE by E.coli transformants in aqueous phase system, and discussed the possible application of this reaction system in industry.

Optically active ethyl (S)-4- chloro -3- hydroxybutyrate is an important chiral compound in the synthesis of pharmaceutical preparations. Its dextrorotatory form is the precursor of L- carnitine, and its levorotatory form is the starting material of hydroxymethylglutaryl-CoA reductase inhibitor. Many studies have described the asymmetric reduction of COBE by microorganisms or enzymes based on baker's yeast. We have previously known that COBE is catalyzed to produce CHBE with 96% optical purity by using cells from Candida Mulan strain AKU4643. There are at least three kinds of stereoselective reductases in this yeast, and the CHBE produced by this yeast is not purely optical. Among these three enzymes, NADPH-dependent carbonyl reductase, we cloned and sequenced the gene encoding S 1 and overexpressed it in Escherichia coli. Escherichia coli transformed cells catalyze COBE to produce pure optical CHBE, and glucose, NADP+ and commercial glucose dehydrogenase are used as promoters of coenzyme factors.

We constructed Bacillus megaterium S 1 and GDH expressed in these three kinds of E.coli transformed cells, and analyzed the reaction mechanism of these strains for catalytic reduction of COBE. Previous reports show that the optical purity of CHBE produced by enzymatic reduction of COBE can reach 92%. It is also mentioned that the substrate (COBE) is unstable in the water phase, and the enzyme is easily passivated, so the reaction is catalyzed by enzymes or microorganisms in the organic solvent/water two-phase system. We have studied the reduction of COBE to pure optical CHBE in water single-phase system, and discussed the possible application of this reaction system in industrial application.

Materials and methods

Bacterial strains and plasmids

The Escherichia coli strains used in this study are JM 109 and HB 10 1. Plasmid pGDA2, in which the GDH gene from Bacillus megaterium was inserted into pKK223-3, was provided by Professor I. Urabe of Osaka University (Makino et al., 1989). Plasmids pSL30 1 and pTrc99A were purchased from Invitrogen (USA) and Amersham pharmacia Biotechnology (UK), respectively. Plasmids pUC 19 and pSTV28 (Homma et al.1995; Gao Qiao et al. (1995) purchased from Sasuke Takara (Japan).

Materials and methods

Strains and plasmids

The Escherichia coli used in this experiment are JM 109 and HB 10 1. The GDH gene from Bacillus megaterium was inserted into Pkk233-3 plasmid, while the pGDA2 plasmid with GDH gene fragment was provided by Professor Urabe of Osaka University. Plasmids pSL30 1 and pTrc99A were purchased by Invitrogen Company of the United States and British Company respectively. Plasmids pUC 19 and pST28 were purchased by takara company in Japan.

The recombinant plasmid used in this study was constructed as follows (figure 1): plasmid pGDA2 was digested with EcoRI and PstI to isolate a DNA fragment of about 0.9 kilobase pairs (kb) including GDH gene. The fragment was inserted into the EcoRI-PstI site of plasmid pSL30 1 to construct plasmid pSLG. Plasmid pSLG was digested with EcoRI and XhoI to isolate about 0.9 kb DNA fragment including GDH gene.

The recombinant plasmid used in this experiment was constructed as follows: plasmid pGDA2 was digested with EcoRI and PstI to isolate a DNA fragment containing GDH gene with a size of about 0.9kb. The fragment was inserted into the EcoRI-PstI restriction site of plasmid Psl30 1 to construct plasmid pSLG. Plasmid pSLG was transformed with EcoRI and XhoI.

In order to construct the plasmid pNTS 1G, the 0.9 kb fragment was inserted into the EcoRI-SalI site of pNTS 1, and as mentioned above (Yasohara et al., 2000), pntS 1 was constructed to overproduce s 1. In order to construct plasmid pNTGS 1, plasmid pNTG was first generated. Using pGDA2 as a template, two synthetic primers (primer 1, TAGTCCATATGTATAAAGATTTAG, and primer 2 TCTGAGAATTCTTATCCGCGTCCT) were prepared for polymerase chain reaction (PCR). The fragment produced by PCR was digested with NdeI and EcoRI, and then inserted into the NdeI EcoRI site of plasmid pUCNT, as reported (Nanba et al., 1999), which was constructed by pUC 19 and pTrc99A to obtain pNTG. In order to construct plasmid pNTGS 1, pUCHE containing S 1 gene as a template was used to prepare two synthetic primers (primer 3, gcggaattctaggttaataatgctaaagattctccaaccg, and primer 4, gcggtcgattagggaagctagccaccgtc). The fragment produced by PCR was digested with EcoRI and SalI, and then inserted into EcoRI- SalI site of pNTG to obtain pNTGS 1. Plasmids pNTS 1G, pNTGS 1 or pNTG were transformed into E.coli HB10/.

PNTS 1 was constructed to express the aforementioned S 1. The 0.9kb fragment was inserted into the EcoRI-SalI restriction site of pNTS 1 to construct PNTS1g. In order to construct plasmid pNTGS 1, we need to construct pNTG first. The PCR reaction needs two synthetic primers (primer 1, TAGTCCATATGTATAAAGATTTAG and primer 2, TCTGAGAATTCTTATCCGCGTCCT) and pGDA2 as templates. The fragment obtained by PCR was digested with NdeI and EcoRI, and inserted into the NdeI EcoRI restriction site of plasmid pUCNT to obtain pNTG. According to reports, pUCNT is composed of pUC 19 and pTrc99A. In order to construct the plasmid pNTGS 1, two synthetic primers (Primer 3, GCGGATCTAAGTTAAATGGCTAAGATCCACG, and Primer 4, GCGGTCGACTTAGGAAGCGGCCCCCCCGTC) include the gene S 1 as a template. Pcr product fragments were digested with EcoRI and SalI, and then inserted into the EcoRI-SalI digestion site of pntg to obtain pntg 1. Plasmids pNTS 1G, pNTGS 1 or pNTG were all introduced into E.coli HB10/.

Plasmid pGDA2 was digested with EcoRI and PstI to isolate about 0.9 kb DNA fragment including GDH gene. In order to construct plasmid pSTVG, the fragment was inserted into the EcoRI-PstI site of plasmid pSTV28. The plasmid pSTVG was transformed into Escherichia coli HB 10 1.

Plasmid pGDA2 was digested with EcoRI and PstI to obtain a 0.9kb DNA fragment containing GDH gene. In order to construct pSTVG plasmid, this fragment was inserted into the restriction site of EcoRI-PstI of pSTV28 plasmid. The pSTVG plasmid was introduced into Escherichia coli HB 10 1.

Medium and culture

2×YT medium consists of 1.6% bacterial tryptone and 1.0% yeast.

Extract and 0.5% sodium chloride, pH 7.0. Escherichia coli HB 10 1 carries pNTS 1,

Inoculate pNTG, pNTS 1G or pNTGS 1 into a test tube, which contains

2 ml 2×YT medium supplemented with 0. 1 mg/ml ampicillin,

Then incubated at 37℃ for 65 05 hours while shaking back and forth.

The preculture (0.5 ml) was transferred to a 500 ml shaker.

Flask containing 100 ml of 2×YT medium. Cells are cultured.

Shake it back and forth at 37°C for 65438 03 hours. Escherichia coli HB 10 1

PNTS 1 and pSTVG were also cultured in 2×YT medium.

Add 0. 1 mg/ml ampicillin and 0. 1 mg/ml chloramphenicol.

Culture medium and bacterial culture

2*YT medium contains 1.6% tryptone for bacteria, 1.0% yeast extract, 0.5% NaCl and pH7.0.

Escherichia coli HB 10 1 carrying pNTS 1, pNTG, pNTS 1G or pNTGS 1 was inoculated into 2ml of 2*YT medium containing 0. 1mg/ml ampicillin, and incubated at 37. Inoculate 0.5 ml of bacterial liquid into a 500 ml flask of 100 ml of 2 * YT medium. Cultured in a shaker at 37°C for 65438 03 hours. Escherichia coli HB 10 1 with pNTS 1 and pSTVG plasmids was cultured in 2*YT medium in a similar manner, except that 0. 1 mg/ml ampicillin and 0. 1 mg/ml chloramphenicol were added to the medium.

Preparation and enzyme determination of cell-free extract

Cells were harvested from 100 ml culture solution by centrifugation, suspended in 50ml 100mM potassium phosphate buffer (pH 6.5), and then crushed by ultrasound. Removing cell debris by centrifugation; The supernatant was recovered as a cell-free extract. The activity of carbonyl reductase S 1 (COBE reduction activity) was determined by spectrophotometry as follows: The determination mixture consisted of 100 mM potassium phosphate buffer (pH 6.5), 0. 1 mM NADPH and 1 mM COBE. The reactants were incubated at 30℃ and the decrease of absorbance at 340 nm was monitored. The mixture for measuring GDH activity consists of 1 M Tris-HCl buffer (pH 8.0), 100 mM glucose and 2 mM NADP+. The reactants were incubated at 25℃ and the increase of absorbance at 340 nm was monitored. One unit of S 1 or GDH is defined as the amount of catalytic reduction 1 μmol NADP+ or oxidation 1 μmol NADPH per minute, respectively. Measurement of protein concentration by protein.

An analysis kit containing coomassie brilliant blue (Nacalai Tesque, Japan),

Bovine serum albumin was used as the standard (Bradford 1976).

Cell-free extract and enzyme identification

100ml culture medium was centrifuged to harvest the bacteria, suspended with 50m l 0. 1mol/LpH 6.5, and then ultrasonically crushed. Cell debris can be removed by centrifugation, and the collected supernatant is a cell-free extract. The activity of carbonyl reductase S 1 was determined by spectrophotometer as follows: The measured mixture included 0. 1mol/LpH6.5 potassium dihydrogen phosphate buffer, 0. 1mMNADPH and 1mMCOBE. The reaction was carried out at 30℃, and its absorbance at 340nm was monitored at any time. The mixture used to determine GDH includes: 1m Tris-HCl buffer, pH 8.0, 100mM glucose and 2mM NADP+. The reaction was carried out at 25℃ and the absorbance at 340nm was monitored. One unit of S 1 or GDH is defined as the catalytic reduction amount of 1μmol NADP+ or the oxidation amount of 1 μmol NADPH per minute. Protein was determined by protein reagent containing coomassie brilliant blue, and bovine serum albumin was used as the standard.

Study on the stability of enzyme

1 ml of 100 mM potassium phosphate buffer (pH 6.5) containing cell-free extract of E.coli HB 10 1 carrying pNTS 1 (S 1: 20 U/ml) and equal volume of each. After the mixture was shaken at 30.d egree. C. for 48 hours, the remaining enzyme activity in the water phase was determined as described above. The mixture containing 100 mM potassium phosphate buffer (pH 6.5), S 1 (20 U/ml) and various concentrations of CHBE was incubated at 30℃ for 24 hours to study the stability of the enzyme in the presence of CHBE. The remaining enzyme activity was determined as described above.

Study on the stability of enzyme

1 ml of 100mM dipotassium phosphate buffer (pH6.5) containing cell-free extract of E.coli HB 10 1 containing pNTS 1 plasmid was mixed with an equal volume of organic solvent. After the mixture was shaken at 30℃ for 48 hours, the residual enzyme activity in the water phase was the above enzyme activity.

In the two-phase system reaction, E.coli cells expressing S 1 gene and E.coli cells expressing GDH gene were used to reduce COBE.

The reaction mixture contains 15 ml of culture medium of E.coli HB 10 1 carrying pNTG, 17 ml of culture medium of E.coli HB10/carrying pNTS 1, and1. 2.5 g COBE, 25 Ml n-butyl acetate and about 25mg Triton X-655 were used to control the pH of the reaction mixture to 6.5 with 5 m sodium hydroxide. At 2 hours, 1.25 g of COBE and 2.5 g of glucose were added to the reaction mixture. In order to compare the reaction of Escherichia coli transformants co-expressing GDH and S 1 genes, 30 ml of Escherichia coli culture medium was added.

HB 10 1 carrying pNTS 1G was used to replace the culture medium of Escherichia coli HB10/carrying pNTS 1 and Escherichia coli HB1carrying pnts1. Other components and procedures are the same as above.

Reduction reaction of Escherichia coli cells expressing S 1 gene and GDH gene in two-phase reaction system

The mixture contains 65438+25ml bacterial liquid of Escherichia coli HB 10 1 with pNTG plasmid, and10/7ml bacterial liquid of Escherichia coli HB10/with pNTS 1 plasmid. Use 5M NaOH solution to control the pH value to 6.5. After two hours of reaction,1.25g of glucose and 2.5g of glucose were added to the mixture. Comparing the expression of GDH and S 1 genes in transformed cells of E.coli, the Escherichia coli HB 10 130ml with pNTS 1G plasmid replaced the Escherichia coli HB10 with pNTG and pNTS 1 plasmid. Other components and steps are similar to the above method.

COBE is reduced to (S)-CHBE in the reaction of two-phase system.

The reaction mixture contains 50 ml of culture solution of Escherichia coli HB 10 1 transformant, 3.2 mg of NADP+,1/g of glucose, 10 g of COBE, 50 ml of n-butyl acetate and about 50 mg of Triton X- 100. The reaction mixture was stirred at 30℃ and the pH was controlled to 6.5 with 5 M sodium hydroxide. 5 g COBE/5.5 g glucose and 10 g COBE/ 1 1 g glucose were added to the reaction mixture at 3 hours and 7 hours respectively; 3.2 mg of NADP+ was added at 26 hours.

Production of (S)-CHBE by reduction of COBE in two-phase system

The reaction mixture contained 50 ml of transformed cell culture medium of Escherichia coli HB10/kloc-0, 3.2 mg of NADP+, 1 1 g.

Glucose, 10gCOBE, 50ml butyric acid, 50mg polyethylene glycol octylphenyl ether Triton X- 100.

Mix evenly at 30°C, and control the pH value to 6.5 with 5M NaOH solution. Add 5gCOBE and 5.5g glucose respectively at the 3rd hour or 10gCOBE and 1 1g glucose respectively at the 7th hour, and add 3.2gNADP+ respectively at the 26th hour.

COBE is reduced to (S)-CHBE in water system reaction.

The reaction mixture consists of 50 ml of culture solution of Escherichia coli HB 10 1 transformant, 3. 1 mg NADP+,1g glucose and about 50 mg of Triton X- 100. The reaction mixture was stirred at 30.d egree. C.. Continuously adding15g COBE at a rate of about 0.02g/min through a micro feeder for about 65438 02h. The pH of the reaction mixture was controlled at 6.5 with 5 M sodium hydroxide. The reaction mixture was extracted with 65438 +000 ml of ethyl acetate. The organic layer was dried with anhydrous sodium sulfate and then evaporated in vacuum.

COBE was reduced to (S)-CHBE in aqueous phase.

The reaction system is a bacterial solution transformed from 50 ml of Escherichia coli HB 10 1, 3. 1 mna DP+,1g of glucose and about 50 mg of polyethylene glycol octylphenyl ether Triton X- 100. During 65438 02 hours, the reaction mixture was continuously added to the system at 30℃ at the rate of 0.02 g/min. Use 5M NaOH solution to control the pH value to 6.5. The reaction mixture was extracted with 100 ml of ethyl acetate. The organic layer was dried with anhydrous sodium sulfate and dehydrated in vacuum.

analyse

The reaction mixture was centrifuged to obtain an organic layer, and CHBE and COBE were analyzed by gas chromatography. As described earlier (Yasohara et al., 1999), the optical purity of CHB E was analyzed by high performance liquid chromatography (HPLC).

Enzymes and chemicals

Restriction endonucleases and DNA polymerase were purchased from.

Tara Shuzo (Japan). COBE (molecular weight: 164.59) was purchased.

From Tokyo Chemical Industry (Japan). Racemic CHBE (molecule

Weight: 166.60) is obtained by using

NaBH4。 All other chemicals used are analytical grade.

Commercial.

analyse

The CHBE and COBE of the organic layer obtained by centrifuging the reaction mixture were determined by gas chromatography. As described above, the optical purity of COBE was analyzed by high performance liquid chromatography.

Enzymes and chemical reagents

Restriction endonuclease and DNA polymerase were purchased from takara Company, COBE (molecular weight: 164.59) was purchased from Tokyo Kasei Kogyo Company, and racemic CHBE (molecular weight: 166.6) was synthesized from COBE and NaBH4. All other chemical reagents are analytical grade and commercial reagents.

Construction of Escherichia coli transformants overproducing S 1 and GDH

In order to express carbonyl reductase S 1 and GDH gene in the same E.coli cell, four expression vectors were constructed (Figure 1). Plasmids pNTS 1G and pNTGS 1 contain the S 1 gene from Magnoliaceae, the GDH gene from Bacillus megaterium, the lac promoter from pUC 19 and the terminator from pTrc99A. Plasmid pNTS 1 contains S 1 gene, lac promoter from pUC 19 and terminator from pTrc99A. The enzyme activity in the cell-free extract of Escherichia coli transformant is shown in table 1. E.coli HB 10 1 cells carrying vector plasmid pUCNT did not detect S 1 or GDH activity. Escherichia coli HB 10 1 carrying pNTS654 38+0G or pNTGS 1 showed the activity of S 1 and GDH, but was not induced by isopropyl -β-D- thiogalactopyranoside (IPTG). The S 1 activity of these two transformants is lower than that of GDH. In order to obtain transformants with S 1 activity equal to or greater than GDH activity level, we used low-copy vector pSTV28 (Homma et al.,1995; Takahashi et al., 1995) to express GDH gene. It is possible to increase the activity of S 1 by decreasing the activity of GDH. Plasmid pSTVG contains GDH gene, lac promoter, chloramphenicol resistance gene and replication origin from pACYC 184 to be compatible with plasmid pNTS 1. In Escherichia coli HB 10 1 carrying pNTS65438 +0 and pSTVG, the activity of S65438 +0 is higher than that of GDH, but this GDH

The level may be too low to be regenerated in the COBE reduction reaction as described below.

Construction of Escherichia coli transformed cells overproducing S 1 and GDH

In order to express carbonyl reductase S 1 and GDH gene in the same E.coli cell, four expression vectors need to be constructed. Plasmids pNTS 1G and pNTGS 1 contain S 1 gene from magnolia e, GDH gene from Bacillus megaterium, LAC promoter from pUC 19 and terminator from pTrc99A. Plasmid pNTS 1 contains S 1 gene. The enzyme activities of cell-free extracts from transformed cells in Escherichia coli are shown in table 1. The activity of S 1 and GDH could not be detected in Escherichia coli cells carrying the transport plasmid pUCNT. Plasmids carrying pNTS 1G or pNTGS 1 have the activity of S 1 and GDH, and are not induced by IPTG. Among the two transformed strains, the activity of S 1 was lower than that of GDH. In order to obtain E.coli transformed strains with S 1 activity equal to or greater than GDH, we used low-copy vector pSTV28 to express GDH gene. It may increase the activity of S 1 by decreasing the activity of GDH. Plasmid pSTVG contains GDH gene, lac promoter, chloramphenicol resistance gene and replication initiation site from pACYC 184, which is compatible with pNTS 1. The activity of S 1 is higher than that of GDH in E.coli transformed cells carrying pNTS 1 and pSTVG, but the activity of GDH may be too low to be regenerated in COBE reduction reaction.

It's too long, the number of words is limited, and I can't send it. I don't care about grades. I seldom log in. This should be regarded as genetic engineering. I translated it myself before, which is not very good. You can contact my email address if you like. iamecho23@ 163.com